GFP MUTATION AND ITS MANUFACTURE

摘要

PURPOSE: Provided is a green fluorescence protein (GFP) mutant which is very useful as a reporter molecule to monitor gene expression and protein position while holding bioluminescence and clarifying domains. CONSTITUTION: A method for manufacturing a green fluorescence protein (GFP) mutant is characterized by the following steps of: i) amplifying NEX δ-GFP segments that code GFP through polymerase chain reaction (PCR) using primers, gfp1 (5'GGGAATTCCATATGAGAAAAGGAGAAGA) and gfp2 (5'GACACCAGACCAACTGG); ii) cutting PCR products with restriction enzymes Nde I and BamH I and inserting vector Nde I/BamH I-linear pET3a inducing GFP into E. coli; and iii) manufacturing various GFP mutants by using restriction enzymes, exonuclease, and recombinant primers. And the strength of bioluminescence of GFP mutants are measured in E. coli transformed by pET3a-GFP.