| 摘要 |
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl(50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of “Ct” indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.2 cl, 6 dwg, 3 tbl, 2 ex |
