Detection and identification of Staphylococcus species, useful for diagnosis and testing of e.g. foods, based upon amplification of a specific genomic sequence

摘要

Detecting and/or identifying bacteria (A) of the genus Staphylococcusin a biological sample, is new. Detecting and/or identifying bacteria (A) of the genus Staphylococcusin a biological sample comprises: (1) extracting nuclear material (B) from (A); (2) amplifying at least one target sequence in (B), using at least one amplification primer containing at least 10 nucleotides (nt) from sequence (1) and/or at least one amplification primer containing at least 10 nt from sequence (2); and (3) detecting the resulting amplicon. taacctacctataagactgg (1) tcaccccaatcatttgtccc (2) Independent claims are also included for: (1) amplification primer containing at least 10 nt from (1) or (2); (2) pairs of amplification primers, one derived from (1) and the other from (2); (3) diagnostic kit comprising at least one primer of (1); (4) hybridization probe containing at least 10 nt from (1) or (2); and (5) composition for detecting (A) comprising at least one probe of (4).