| 摘要 |
DNA hybridisation probes specific to the male genome of ruminants (esp. cattle) have a hybridisation profile, as determined by hybridisation with enzyme-digester male genomic DNA, exhibiting at least one band specific to the male genome of the ruminants in question. The hybridisation profile determined by hybridisation with EcoRI-digested male genomic DNA, exhibits a 7 kb band specific to the male genome of the cattle. The specified probe (b.c.1.2.) comprises 49 base pairs with the 5'-3' sequence ATCAGTGCAGGGACCGAG ATGTGCT CCAAGGAGTGTTTATCGGCTGCTT, or a fragment of this sequence comprising at least 11 consecutive nucleotides, or a fragment with at least 70% homology with this fragment. The profile is repeated at least 2000 times in the bovine male genome. |
