摘要 |
<p>A sex discernment method that uses real-time polymerase chain reaction (PCR) to discern the sex of Coho salmon (Oncorhynchus kisutch) comprises the following steps: extracting and amplifying Coho salmon DNA by PCR, using the fluorescent probe pCsex1 (FAM) 5'-CCTGTGTATACTTGGGAGCGGTAAGCC-3' and a mixture of primers, CSex2s: 5'-CATTATATTTGGCTGAAGAGTCAGTG-3' and CSex2r: 5'-GGAACAGATGGAGCGGTCTTC-3'; identifying the presence of the sequence CATTATATTTGGCTGAAGAGTCAGTGTTCTGCTTGTATTAATATAATATAGAGCTTGAATTTAGACTTGAATTCTCACAGTTGGAGGTCAGTTTAGTTATGAATTAAACCTGTGTATACTTGGGAGCGGTAAGCCATGTGCCCATTTACAAAGTCTGACCAGAGAAGACCGCTCCATCTGTTCC, as a fluorescence signal, the presence of the fluorescence signal indicating male Coho salmon and the absence of the fluorescence signal indicating female Coho salmon. The mixture of primers and the kit comprising the mixture of primers and the fluorescent probe are also disclosed.</p> |